View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1134_low_55 (Length: 201)
Name: NF1134_low_55
Description: NF1134
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1134_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 55954262 - 55954380
Alignment:
| Q |
1 |
tgtatcgcatctgctgcacaacgttggatagtgttacattttaatttatacaaaaagtctagaatatgacaacaaaatatgattgtattgtagttgcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55954262 |
tgtatcgcatctgctgcacaacgttggatagtgttacattttaatttatacaaaaagtctagaatatgacaacaaaatatgattgtattgtagttgcaga |
55954361 |
T |
|
| Q |
101 |
ggatctatgtttgcaaaat |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
55954362 |
ggatctatgtttgcaaaat |
55954380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University