View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11350_low_5 (Length: 242)
Name: NF11350_low_5
Description: NF11350
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11350_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 24 - 227
Target Start/End: Complemental strand, 21369011 - 21368807
Alignment:
| Q |
24 |
gcacaaaatttgaaaatggagctctac-accaacggaacaatgaatctaacagatcaattgggaaaatggcagggagctacttctcaatacacagatatg |
122 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| | |||||||||||||| ||||||||||||||||||||||||| ||||||||| |||||| ||||||| |
|
|
| T |
21369011 |
gcacaaaatttgaaaatggagccctaccaccagcagaacaatgaatctagcagatcaattgggaaaatggcagggggctacttctgaatacatagatatg |
21368912 |
T |
|
| Q |
123 |
tcatcacctaaatcatccatacctgactttaatttcttattaagtgcccaatcgagggctttctgaagtggtttagtcaaagaaggtaccacagagctgg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||| |||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
21368911 |
tcatcacctaaatcatccatacctgactttgatgtctcattaagtgcccaatcgagggctttatgaagtggttcagtcaaagacagtaccacagggctgg |
21368812 |
T |
|
| Q |
223 |
agtag |
227 |
Q |
| |
|
||||| |
|
|
| T |
21368811 |
agtag |
21368807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University