View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11351_high_4 (Length: 225)

Name: NF11351_high_4
Description: NF11351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11351_high_4
NF11351_high_4
[»] chr5 (1 HSPs)
chr5 (9-208)||(2653603-2653802)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 208
Target Start/End: Complemental strand, 2653802 - 2653603
Alignment:
9 gaggagcagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaacccgcctttttcacctattgggcgagtatgaagtgtcgtct 108  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||    
2653802 gaggagaagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaaccagcctttttcgcctattgggcgagtatgaagtgtcttct 2653703  T
109 cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagtaggaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2653702 cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagtaggaa 2653603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University