View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11351_low_7 (Length: 248)
Name: NF11351_low_7
Description: NF11351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11351_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 185
Target Start/End: Complemental strand, 41852138 - 41851954
Alignment:
| Q |
1 |
tagctacacaaatcaattacgtttttattttaccggggtctattttaaattgaaagttgagtctccaattttataggaacaactaaatacctgatacacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
41852138 |
tagctacacaaatcaattacgtttttattttaccggggtctattttaaattgaaagtgaagtctcctattttataggaacaactaaatacctgatacacc |
41852039 |
T |
 |
| Q |
101 |
acttatgatataagaaagataaagatagtaaaattatagaggtaatagattagtgatatgatagaacaacaatgataaatataca |
185 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41852038 |
acttttgagataagaaagataaagatagtaaaattatagaggtaatagattagtgatatgatagaacaacaatgataaatataca |
41851954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University