View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11351_low_8 (Length: 225)
Name: NF11351_low_8
Description: NF11351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11351_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 9 - 208
Target Start/End: Complemental strand, 2653802 - 2653603
Alignment:
| Q |
9 |
gaggagcagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaacccgcctttttcacctattgggcgagtatgaagtgtcgtct |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
2653802 |
gaggagaagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaaccagcctttttcgcctattgggcgagtatgaagtgtcttct |
2653703 |
T |
|
| Q |
109 |
cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagtaggaa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653702 |
cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagtaggaa |
2653603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University