View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11353_low_17 (Length: 270)
Name: NF11353_low_17
Description: NF11353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11353_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 8 - 252
Target Start/End: Original strand, 41515616 - 41515860
Alignment:
| Q |
8 |
tcataaagagaagtgttcaagtttctttggtctttcaggaggcttgatcttttgacaacacgtagctagtttctgacaattgtgaaccatgaatagcatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41515616 |
tcataaagagaagtgttcaagtttctttggtctttcaggaggcttgatcttttgacaacacgtagctagtttctgacaattgtgaaccatgaatagcatt |
41515715 |
T |
|
| Q |
108 |
tgattagatatattagtttgatttaccaaagattgaaaaattactggtgttaaccatgtgaaatgttctacagttgtttggatgctctaaggcacccatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41515716 |
tgattagatatattagtttgatttaccaaagattgaaaaattactggtgttaaccatgtgaaatgttctacagttgtttggatgctctaaggcacccatt |
41515815 |
T |
|
| Q |
208 |
cctttgtgggccaagatggcgagtagttccatcaatggatattat |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41515816 |
cctttgtgggccaagatggcgagtagttccatcaatggatattat |
41515860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University