View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11353_low_18 (Length: 257)
Name: NF11353_low_18
Description: NF11353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11353_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 2305401 - 2305155
Alignment:
| Q |
1 |
ccctaattttttgttcatactttcaaatcatttaaaaactaattaagatttgaaataggcaagatcgttgatcggttatagtgtcaacatagttggtatg |
100 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2305401 |
ccctaattttttgttcatgctttcgaatcatttaaaaactaattaagatttgaaataggcaagatcgttgatcggttatagtgtcaacataattggtatg |
2305302 |
T |
 |
| Q |
101 |
ttagttaacaaagcgatacttttgcacactttttgttgctaaaaatagttggatccctcaacaggtgcttggatccgtaaggagttcgatcatgttgtgc |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2305301 |
ttagttaacaaagtgatacttttgcacactttttgttgctaaaaatagttggatccctcaacatgtgcttggatcggtaaggagttcgatcatgttgtgc |
2305202 |
T |
 |
| Q |
201 |
cgcaacatgttcgttggacatatatgttgcttctttagtggcctttg |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2305201 |
cgcaacatgttcgttggacatatatgttgcttctttagtggcctttg |
2305155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University