View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11353_low_23 (Length: 240)
Name: NF11353_low_23
Description: NF11353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11353_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 2 - 223
Target Start/End: Original strand, 37173668 - 37173889
Alignment:
| Q |
2 |
tgtttataaagtcacactgattggttgtaatttgttgacaccgtaaagctttttacaatgaccatgtttaaaatttaaactcttatttaaaagcagaata |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37173668 |
tgtttataaagtcacactgattggttgtaatttgttgacactgtaaaactttttacaatgaccatgtttaaaatttaaactcttatttaaaagcagaata |
37173767 |
T |
|
| Q |
102 |
cttaagggcgtttcaactctaccaatgactctggagatgtcggattcgtcaaattaaaggtgagacttgataatgataatgatgaatcccactgtataat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37173768 |
cttaagggcgtttcaactctaccaatgactctggagatgtcggattcgtcaaattaaaggtgagacttgatactgataatgatgaatcccactgtataat |
37173867 |
T |
|
| Q |
202 |
cagttcatctcctgttgaaaag |
223 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37173868 |
cagttcatctcctgttgaaaag |
37173889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University