View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11354_low_3 (Length: 347)
Name: NF11354_low_3
Description: NF11354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11354_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 2 - 337
Target Start/End: Original strand, 8548768 - 8549111
Alignment:
| Q |
2 |
gaatttcaagttctcctcttttcagtatttatagtgtgtgagtctaaccgttaggtatttagnnnnnnnntagaatggagagtgtaaattacnnnnnnna |
101 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| ||||| | |
|
|
| T |
8548768 |
gaatttcaagttctcctcttctcagtatttatagtgtgtgagtctaaccattaggtatttaagaaaaaaatagaatggagagtgtatattacttttttta |
8548867 |
T |
|
| Q |
102 |
ggtggactta-gagttctttcnnnnnnnngaaa-------ggtggacttagagtaagggcttgtgtatgtttggtctgcctctgaattttgtcttctaca |
193 |
Q |
| |
|
|||||||||| |||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8548868 |
ggtggacttaagagttctttcaaaaaaaaaaaaaaaaaaagttggacttagagtaagggcttgtgtatgtttggtctgcctctgaattttgtcttctaca |
8548967 |
T |
|
| Q |
194 |
acactaattttggtccatgcattaagctacttttgagtgataagagggtttgaggaggacttcattggtttttcaactgtgtattggcaatgcatatgga |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8548968 |
acactaattttggtccatgcattaagctacttttgagtgataagagggtttgaggaggacttcattggtttttcaactgtgcattggcaatgcatatgga |
8549067 |
T |
|
| Q |
294 |
tatggttgatattttgttcgatgctctttaggctctgtgctgct |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8549068 |
tatggttgatattttgttcgatgctctttaggctctgtgttgct |
8549111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University