View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11355_high_3 (Length: 222)
Name: NF11355_high_3
Description: NF11355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11355_high_3 |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 39 - 207
Target Start/End: Original strand, 51264831 - 51264999
Alignment:
| Q |
39 |
gcaaatcgcagaagcggtgcttacttttaatcgcaaaacgatttcatgtaagcggtgacttacggtaatgaagtgagtgaccaatcgcaaaactagctgt |
138 |
Q |
| |
|
||||| ||||||| | ||| ||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
51264831 |
gcaaaacgcagaaactgtgtttacttttaatcgcaaatggctttcatgtaagcggtgacttacggtaatgaagtgagtgaccaatagcaaaactagctgt |
51264930 |
T |
 |
| Q |
139 |
gtttgttaattcaatttcttttcaatcgaacccgtcgcaaccgcaaatcgcatgttgggaagtaggaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51264931 |
gtttgttaattcaatttcttttcaatagaacccgtcgcaaccgcaaatagcatgttgggaagtaggaag |
51264999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 39 - 90
Target Start/End: Original strand, 51264761 - 51264812
Alignment:
| Q |
39 |
gcaaatcgcagaagcggtgcttacttttaatcgcaaaacgatttcatgtaag |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51264761 |
gcaaatcgcagaagcggtgcttacttttaatagcaaaacgatttcatgtaag |
51264812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 111 - 207
Target Start/End: Original strand, 44412 - 44508
Alignment:
| Q |
111 |
gtgagtgaccaatcgcaaaactagctgtgtttgttaattcaatttcttttcaatcgaacccgtcgcaaccgcaaatcgcatgttgggaagtaggaag |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
44412 |
gtgagtaaccaatcgcaaaactagctgtgtttgttaattcaatttcttttcaatagaacccgtcgcaactgcaaatcgcatgttgggaagaaggaag |
44508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 111 - 207
Target Start/End: Complemental strand, 27442949 - 27442853
Alignment:
| Q |
111 |
gtgagtgaccaatcgcaaaactagctgtgtttgttaattcaatttcttttcaatcgaacccgtcgcaaccgcaaatcgcatgttgggaagtaggaag |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
27442949 |
gtgagtaaccaatcgcaaaactagctgtgtttgttaattcaatttcttttcaatagaacccgtcgcaactgcaaatcgcatgttgggaagaaggaag |
27442853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University