View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11356_high_28 (Length: 324)
Name: NF11356_high_28
Description: NF11356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11356_high_28 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 324
Target Start/End: Complemental strand, 25958340 - 25958018
Alignment:
| Q |
1 |
ttctcagatgttgagatgtttgattcagacattgggcggtggatccccacacgttcaatgctagagaaggtaaagtaggtctttcaaatggtaaatattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25958340 |
ttctcagatgttgagatgtttgattcagacattgggcggtggatccccacacgttcaatgctagagaaggtaaagtaggtctttcaaatggtaaatattt |
25958241 |
T |
|
| Q |
101 |
atgtcctgattgagatttgagaggtataattatcaataactggttacaacaggagagttcatgtggttttttaggcttatgctgcttatgatgccaactg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
25958240 |
atgtcctgattgagatttgagaggtataattatcaataactggttacaacaggagagttcatgtgtttttttaggcttatgctgcttatgatgccaactg |
25958141 |
T |
|
| Q |
201 |
gattaattgtagaacatgctctttcttccattttcattttattcctcnnnnnnnnnnccttttcaagaaatgacatgtaggtagttctatgatgttatgg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25958140 |
gattaattgtagaacatgctctttcttccattttcattttattcctc-tttttttttccttttcaagaaatgacatgtaggtagttctatgatgttatgg |
25958042 |
T |
|
| Q |
301 |
gaaattttgtatatgcttgcatca |
324 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25958041 |
gaaattttgtatatgcttgcatca |
25958018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University