View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11356_high_29 (Length: 324)
Name: NF11356_high_29
Description: NF11356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11356_high_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 18 - 236
Target Start/End: Original strand, 41509001 - 41509222
Alignment:
| Q |
18 |
gtgggttcctccctccactcatgatgatgannnnnnnnn-gtacccttttgaacaaagatttcagatttttaacacattttgttaattaatgattggaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41509001 |
gtgggttcctccctccactcatgatgatgattttttttttgtacccttttgaacaaagatttcagatttttaacacattttgttaattaatgattggaat |
41509100 |
T |
 |
| Q |
117 |
taattctctcctccgtgattatagatgattttgaaatgggtttgaa-nnnnnnnnctttgtttgtggagaattgttttttatgaccagccagaatccaac |
215 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41509101 |
taattttctcctccgtgattatagatgattttgaaatgggtttgaatttttttttctttgtttgtggagaattgttttttatgaccagccagaatccaac |
41509200 |
T |
 |
| Q |
216 |
aagaccctgac-aagttaggaa |
236 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
41509201 |
aagaccctgacaaagttaggaa |
41509222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University