View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11356_high_30 (Length: 295)

Name: NF11356_high_30
Description: NF11356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11356_high_30
NF11356_high_30
[»] chr8 (2 HSPs)
chr8 (20-288)||(27185240-27185515)
chr8 (155-210)||(4555607-4555662)
[»] chr7 (1 HSPs)
chr7 (23-215)||(5104600-5104795)
[»] chr6 (2 HSPs)
chr6 (22-215)||(29974082-29974279)
chr6 (168-215)||(3244597-3244644)
[»] chr2 (3 HSPs)
chr2 (38-98)||(21647522-21647582)
chr2 (38-98)||(3934503-3934565)
chr2 (174-215)||(21647395-21647436)
[»] scaffold0393 (1 HSPs)
scaffold0393 (38-98)||(10764-10826)
[»] chr5 (2 HSPs)
chr5 (38-98)||(3175091-3175153)
chr5 (171-215)||(4222331-4222375)
[»] chr4 (1 HSPs)
chr4 (38-98)||(45144866-45144928)
[»] chr1 (2 HSPs)
chr1 (171-215)||(6901999-6902043)
chr1 (42-98)||(47192663-47192719)


Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 20 - 288
Target Start/End: Complemental strand, 27185515 - 27185240
Alignment:
20 caggtgctctttgggtctttcgggagtgaggcaggggtatgcttgccccatgcaagtatacttcagcctcactgtttgaagccttgggtttgggtgttct 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27185515 caggtgctctttgggtctttcgggagtgaggcaggggtatgcttgccccatgcaagtatacttcagcctcactgtttgaagccttgggtttgggtgttct 27185416  T
120 gtgtatgtgcggcacctttgtatgtttaccgtttattttatccgcgagttgttgtgcgtcttgcatacactcgacgtgaataatatttgccgtttc---- 215  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||        
27185415 gtgtatgtgcggcacctttgtatgtttaccgtttattttatctgcgagttgttgtgcgtcttgcatacactcgacgtgaataatatttgccgtttcaaaa 27185316  T
216 ---nnnnnnnnnnnnnnncctgaaactagtatcaacacgtgttgtgtcatcttgcacaatcaacttcttcatctct 288  Q
                      |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||    
27185315 aaaaaaaaaaaaaaaaaacctgaaactagtatcaacacgtattgtgtaatcttgcacaatcaacttcttcatctct 27185240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 155 - 210
Target Start/End: Complemental strand, 4555662 - 4555607
Alignment:
155 ttttatccgcgagttgttgtgcgtcttgcatacactcgacgtgaataatatttgcc 210  Q
    ||||||||||||||| |||||||  |||||||||||||||  |||||| |||||||    
4555662 ttttatccgcgagtttttgtgcgctttgcatacactcgactagaataaaatttgcc 4555607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 23 - 215
Target Start/End: Original strand, 5104600 - 5104795
Alignment:
23 gtgctctttgggtctttcgggagtgaggcaggggtatgcttgccccatgcaagtatacttcagcctcactgtttgaagccttgggtt-tgggtgttctgt 121  Q
    |||||| |||||| ||||||| |||||||||||||||||| ||||  | ||||||||  || ||||||||||||||  |||||||||  |||||||| ||    
5104600 gtgctccttgggtttttcgggggtgaggcaggggtatgctcgccctttacaagtatatctcggcctcactgtttgataccttgggttcagggtgttccgt 5104699  T
122 gtatgtgcggca-cctttgtatgtttaccgtttattttatccgcgag-ttgttgtgcgtcttgcatacactcgacgtgaataatatttgccgtttc 215  Q
    |||||||||||| ||||||||||| | | |||| || |||||||||| |||||||||  ||||||| | || ||||||||||||||||||||||||    
5104700 gtatgtgcggcaccctttgtatgtcttctgttttttctatccgcgagtttgttgtgcaccttgcattcccttgacgtgaataatatttgccgtttc 5104795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 22 - 215
Target Start/End: Original strand, 29974082 - 29974279
Alignment:
22 ggtgctctttgggtctttcgggagtgaggcaggggtatgcttgccccatgcaagtatacttcagcctcactgtttgaagccttgggtt-tgggtgttctg 120  Q
    ||||||| |||||  ||||| | |||||||||||||||||| ||||  | ||||||||  ||  |||||||||||||  |||||||||  || ||||| |    
29974082 ggtgctccttggggttttcgagggtgaggcaggggtatgctcgccctttacaagtatatctcgacctcactgtttgataccttgggttcaggatgttccg 29974181  T
121 tgtatgtgcggca-cctttgtatgtttaccgtttattt-tatccgcgagt-tgttgtgcgtcttgcatacactcgacgtgaataatatttgccgtttc 215  Q
    ||||||||||||| ||||||||||| | | |||| ||| ||||||| ||| ||||||||  ||||||| | ||||||||||||||||||| |||||||    
29974182 tgtatgtgcggcaccctttgtatgtcttctgtttttttctatccgcaagtatgttgtgcaccttgcattcgctcgacgtgaataatatttaccgtttc 29974279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 168 - 215
Target Start/End: Complemental strand, 3244644 - 3244597
Alignment:
168 ttgttgtgcgtcttgcatacactcgacgtgaataatatttgccgtttc 215  Q
    |||||||||| ||||||||| ||||| |||||||||||| ||||||||    
3244644 ttgttgtgcgccttgcatactctcgatgtgaataatattagccgtttc 3244597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 38 - 98
Target Start/End: Complemental strand, 21647582 - 21647522
Alignment:
38 ttcgggagtgaggcaggggtatgcttgccccatgcaagtatacttcagcctcactgtttga 98  Q
    |||||||||||||||| |||||||||| | |||||||||||| |||||||||| |||||||    
21647582 ttcgggagtgaggcagtggtatgcttgactcatgcaagtatatttcagcctcattgtttga 21647522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 98
Target Start/End: Complemental strand, 3934565 - 3934503
Alignment:
38 ttcgggagtgaggcaggggtatgcttgccccatgcaag--tatacttcagcctcactgtttga 98  Q
    |||||||||||||||||||||||||||| | |||| ||  |||||||| |||||| |||||||    
3934565 ttcgggagtgaggcaggggtatgcttgctctatgctagtatatacttcggcctcattgtttga 3934503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 21647436 - 21647395
Alignment:
174 tgcgtcttgcatacactcgacgtgaataatatttgccgtttc 215  Q
    |||||||||||||  |||||||||||||||||||||| ||||    
21647436 tgcgtcttgcatattctcgacgtgaataatatttgccatttc 21647395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0393 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0393
Description:

Target: scaffold0393; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 98
Target Start/End: Complemental strand, 10826 - 10764
Alignment:
38 ttcgggagtgaggcaggggtatgcttgccccatgcaag--tatacttcagcctcactgtttga 98  Q
    |||||||||||||||||||||||||||| | |||| ||  |||||||| |||||| |||||||    
10826 ttcgggagtgaggcaggggtatgcttgctctatgctagtatatacttcggcctcattgtttga 10764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 98
Target Start/End: Original strand, 3175091 - 3175153
Alignment:
38 ttcgggagtgaggcaggggtatgcttgccccatgcaag--tatacttcagcctcactgtttga 98  Q
    |||||||||||||||||||||||||||| | |||| ||  |||||||| |||||| |||||||    
3175091 ttcgggagtgaggcaggggtatgcttgctctatgctagtatatacttcggcctcattgtttga 3175153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 215
Target Start/End: Complemental strand, 4222375 - 4222331
Alignment:
171 ttgtgcgtcttgcatacactcgacgtgaataatatttgccgtttc 215  Q
    ||||||||||||||||  ||||||| |||||||||||||| ||||    
4222375 ttgtgcgtcttgcataatctcgacgagaataatatttgccttttc 4222331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 98
Target Start/End: Original strand, 45144866 - 45144928
Alignment:
38 ttcgggagtgaggcaggggtatgcttgccccatgcaag--tatacttcagcctcactgtttga 98  Q
    |||||||||||||||||||||||||||| | |||| ||  |||||||| |||||| |||||||    
45144866 ttcgggagtgaggcaggggtatgcttgctctatgctagtatatacttcggcctcattgtttga 45144928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 215
Target Start/End: Original strand, 6901999 - 6902043
Alignment:
171 ttgtgcgtcttgcatacactcgacgtgaataatatttgccgtttc 215  Q
    |||||||||||||||| |||||||| ||||||| |||||| ||||    
6901999 ttgtgcgtcttgcatatactcgacgagaataatgtttgccatttc 6902043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 98
Target Start/End: Original strand, 47192663 - 47192719
Alignment:
42 ggagtgaggcaggggtatgcttgccccatgcaagtatacttcagcctcactgtttga 98  Q
    |||||||| ||||||||||||||| | |||| |||||||||| |||| | |||||||    
47192663 ggagtgagacaggggtatgcttgctctatgctagtatacttcggccttattgtttga 47192719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University