View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11356_low_37 (Length: 238)
Name: NF11356_low_37
Description: NF11356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11356_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 62 - 214
Target Start/End: Complemental strand, 19296671 - 19296519
Alignment:
| Q |
62 |
attatagaagtaatcacatattatatggttttgcaaagtcttgaatggaaatttgatgcagctgtctagattcatgtttagggcaatggttttgaatcat |
161 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19296671 |
attatagaagtaaccacatattatatggttttgcaaagtcttgaatggaaatttgatgcacctgtctagattcatgtttagggcaatggttttgaatcat |
19296572 |
T |
 |
| Q |
162 |
gcacaaactagtctgttttgtatgcgatcattcatttggttgtggtttcttat |
214 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19296571 |
gcacaaactagtctgtcttgtatgtgatcattcatttggttgtggtttcttat |
19296519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 90 - 223
Target Start/End: Complemental strand, 21980353 - 21980220
Alignment:
| Q |
90 |
ttttgcaaagtcttgaatggaaatttgatgcagctgtctagattcatgtttagggcaatggttttgaatcatgcacaaactagtctgttttgtatgcgat |
189 |
Q |
| |
|
|||||||||||||||||||||||||| | | |||||||||||||||| ||||||||||||| || ||||||||||||||||||||| ||||||| ||| |
|
|
| T |
21980353 |
ttttgcaaagtcttgaatggaaattttacgtagctgtctagattcatacttagggcaatggtcttcgatcatgcacaaactagtctgtcttgtatgtgat |
21980254 |
T |
 |
| Q |
190 |
cattcatttggttgtggtttcttatacaggttat |
223 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||| |
|
|
| T |
21980253 |
cattcattaggttgtggtttcttatacaagttat |
21980220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University