View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11356_low_37 (Length: 238)

Name: NF11356_low_37
Description: NF11356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11356_low_37
NF11356_low_37
[»] chr2 (1 HSPs)
chr2 (62-214)||(19296519-19296671)
[»] chr7 (1 HSPs)
chr7 (90-223)||(21980220-21980353)


Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 62 - 214
Target Start/End: Complemental strand, 19296671 - 19296519
Alignment:
62 attatagaagtaatcacatattatatggttttgcaaagtcttgaatggaaatttgatgcagctgtctagattcatgtttagggcaatggttttgaatcat 161  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
19296671 attatagaagtaaccacatattatatggttttgcaaagtcttgaatggaaatttgatgcacctgtctagattcatgtttagggcaatggttttgaatcat 19296572  T
162 gcacaaactagtctgttttgtatgcgatcattcatttggttgtggtttcttat 214  Q
    |||||||||||||||| ||||||| ||||||||||||||||||||||||||||    
19296571 gcacaaactagtctgtcttgtatgtgatcattcatttggttgtggtttcttat 19296519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 90 - 223
Target Start/End: Complemental strand, 21980353 - 21980220
Alignment:
90 ttttgcaaagtcttgaatggaaatttgatgcagctgtctagattcatgtttagggcaatggttttgaatcatgcacaaactagtctgttttgtatgcgat 189  Q
    |||||||||||||||||||||||||| | | ||||||||||||||||  ||||||||||||| ||  ||||||||||||||||||||| ||||||| |||    
21980353 ttttgcaaagtcttgaatggaaattttacgtagctgtctagattcatacttagggcaatggtcttcgatcatgcacaaactagtctgtcttgtatgtgat 21980254  T
190 cattcatttggttgtggtttcttatacaggttat 223  Q
    |||||||| ||||||||||||||||||| |||||    
21980253 cattcattaggttgtggtttcttatacaagttat 21980220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University