View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11356_low_42 (Length: 228)
Name: NF11356_low_42
Description: NF11356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11356_low_42 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0018 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 16 - 212
Target Start/End: Original strand, 68141 - 68344
Alignment:
| Q |
16 |
atgaagacggtgggtgggtgtggattgtaattaaagaaacagaaaatctaaaaccattggcgcccaaccattgtttcctttcctcctcttttctaaaaac |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
68141 |
atgaagacggtgggtgggcgtggattgtaattaaagtaacagaaaatctaaaaccattggcgcccaaccattttttcctttcctcctcttttccaaaaac |
68240 |
T |
 |
| Q |
116 |
caacaaaacctttttcattctcaaatctcaattctc-------acacatccatcttccccctaaataaaaatggcaaacgcatttacttcacaccctaga |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
68241 |
caacaaaacctttttcattctcaaatctcaattctcacacacaacacatccatcttccccctaaataaaaatggcaaacgcatttacttcacaccctaga |
68340 |
T |
 |
| Q |
209 |
aacc |
212 |
Q |
| |
|
|||| |
|
|
| T |
68341 |
aacc |
68344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University