View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11356_low_48 (Length: 211)
Name: NF11356_low_48
Description: NF11356
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11356_low_48 |
 |  |
|
| [»] scaffold1034 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1034 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: scaffold1034
Description:
Target: scaffold1034; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 1488 - 1692
Alignment:
| Q |
1 |
tgagaagccactaatcctatgtataatagcaagcaatttgccacatcnnnnnnnntttggtactgtcaaacatcaagca-------------cctaagat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
1488 |
tgagaagccactaatcctatgtataatagcaagcaatttgccacatcaaaaaaaatttggtactgtcaaacatcaagcatccacatccaggacctaagat |
1587 |
T |
 |
| Q |
88 |
caaacattgtgatctgatctccctttctttcacaacataaatgttgctgagacctctactaccccttcacaatcacaactgcaatttcaacatgatcaca |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1588 |
caaacattgtgatctgatctccctttctttcacaacataaatgttgccgagacctctactaccccttcacaatcacaactgcaatttcaacatggtcaca |
1687 |
T |
 |
| Q |
188 |
actgc |
192 |
Q |
| |
|
||||| |
|
|
| T |
1688 |
actgc |
1692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University