View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11358_high_13 (Length: 313)
Name: NF11358_high_13
Description: NF11358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11358_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 30 - 302
Target Start/End: Complemental strand, 3724203 - 3723931
Alignment:
| Q |
30 |
gaatcaactccaaggaaaaaatgtttcattgttatagggatcaatacagctttcagtagcaggaaacgaagagattctgttcgaggaacttggatgccac |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3724203 |
gaatcaactccaaggaaaaaatgtttcattgttatagggatcaatacagcttttagtagcaggaaacgaagagattctgttcgaggaacttggatgccac |
3724104 |
T |
 |
| Q |
130 |
aaggtggttcaatgatatttcagtgtatccttgttttttctcttcactttttgattctatgtacctaatacatctgacccgtggtttgaaataaataatc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3724103 |
aaggtggttcaatgatatttcagtgtatccttgttttttctcttcactttttgattctatgtacctaatgcatctgacccgtggtttgaaataaataatc |
3724004 |
T |
 |
| Q |
230 |
catcagctgaggatagaaagaagttgcaggaagaaaagggcataatcataaattttgttataggtcacaggtt |
302 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
3724003 |
catcagctgaggatagaaagaagttggaggaagaaaagggcataatcatacgttttgttataggtcgcaggtt |
3723931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University