View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11358_low_1 (Length: 341)
Name: NF11358_low_1
Description: NF11358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11358_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 14 - 306
Target Start/End: Complemental strand, 44546461 - 44546169
Alignment:
| Q |
14 |
agatgaagcagctgagattgtataatactggatggaccatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546461 |
agatgaagcagctgagattgtataatactggatggaccatctgtgatctttatcaagtctgagtcggcttttggatcgttaatgtaaaatttgtgaagaa |
44546362 |
T |
 |
| Q |
114 |
g---gttgtagagctttttcttttgagtattagggtacctaatcttgtgaagaagaaggaaatcatataaatctttttcatgatcccatgttctctttct |
210 |
Q |
| |
|
| || ||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546361 |
gaaggtcgtagagctttttcttttgagtattagggtccctaatcttgtgaagaag---gaaatcatataaatctttttcatgatcccatgttctctttct |
44546265 |
T |
 |
| Q |
211 |
agggttcttctctgaagggggtgccattttttatgttagaaatggttttgatgtgtgnnnnnnntcttttgaagaagaacaaagatggaagaagat |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44546264 |
agggttcttctctgaagggggtgccattttttatgttagaaatggttttgatgtgtgaaaaaaatcttttgaagaagaacaaagatggaagaagat |
44546169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University