View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11358_low_2 (Length: 269)
Name: NF11358_low_2
Description: NF11358
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11358_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 37057790 - 37057533
Alignment:
| Q |
1 |
gttagaacgaccaaaaaccttaatccaatagactccatccaggtgcacgcttttctaccctaaaaatcttgtatatatttgatgcattttatacttagtt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37057790 |
gttagaaagaccaaaaaccttaatccaatagactccatccaggtgcacacttttctaccataaaaatcttgtatatatttgacgcattttatacttagtt |
37057691 |
T |
|
| Q |
101 |
tgagtgtttgcatgtataccattccccttcgcaagagaatgagttgttgttcaaagtttaaccacttcaacgcctccgcaacaatcatcggactgtagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37057690 |
ggagtgtttgcatgtataccattccccttcgcaagagaatgagttgttgttcaaagtttaaccacttcaacgcctccgcaacaatcatcggaccgtagat |
37057591 |
T |
|
| Q |
201 |
cttagatcccatcatgtcgaattagatacatatccatcattcaatcacttaatttcat |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37057590 |
cttagatcccatcatgtcgaattagatacatatcaatcattcaatcacttaatttcat |
37057533 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University