View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11359_low_1 (Length: 239)
Name: NF11359_low_1
Description: NF11359
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11359_low_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 26597687 - 26597909
Alignment:
| Q |
1 |
atgatctaagacagctagtaaatggaacaaggtcaacccatttcccatctataccgacagcggctacggatgagtttttctccggtcaccggaatctgac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597687 |
atgatctaagacagctagtaaatggaacaaggtcaacccatttcccatctataccgacagcggctacggatgagtttttctccggtcaccggaatctgac |
26597786 |
T |
|
| Q |
101 |
agctttgttaactactactcatccacagacacatcaaaaccagtatgagatgatgatgttagggcgtggagtagttcttgaagatttcaatagtatcact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26597787 |
agctttgttaactactactcatccacagacacatcaaaaccagtatgagatgatgatgttagggcgtggagtagttcttgaagatttcaatagtatcact |
26597886 |
T |
|
| Q |
201 |
actcatgtaccaccaccaccttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26597887 |
actcatgtaccaccaccaccttc |
26597909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University