View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1135_high_15 (Length: 295)
Name: NF1135_high_15
Description: NF1135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1135_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 9 - 262
Target Start/End: Original strand, 44865506 - 44865759
Alignment:
| Q |
9 |
cctagctgttgcacttggtgacgatgaagcagatgttgtgatctctcatgactcgagatatcaaaagtaagataaagttcaaacttaacttaatagcttc |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865506 |
cctagctgatgcacttggtgacgatgaagcagatgttgtgatctctcatgactcgagatatcaaaagtaagataaagttcaaacttaacttaatagcttc |
44865605 |
T |
 |
| Q |
109 |
tcatttaaacttttctccggctctggcaatcnnnnnnngctgagagtgagacgaccatttttaggattatggggaaatctatgctttaattgatccatag |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865606 |
tcatttaaacttttctccggctctggcaatctttttttgctgagagtgagacgaccatttttaggattatggggaaatctatgctttaattgatccatag |
44865705 |
T |
 |
| Q |
209 |
tttatgtagtaaagataatgcaaccggagtaagaatggcagaaaagcttgacca |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44865706 |
tttatgtagtaaagataatgcaaccggagtaagaatggcagaaaagcttgacca |
44865759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University