View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1135_high_20 (Length: 232)
Name: NF1135_high_20
Description: NF1135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1135_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 20 - 217
Target Start/End: Complemental strand, 42950431 - 42950233
Alignment:
| Q |
20 |
atatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaagata |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950431 |
atatcctatggttacagaggagtatgatcatggaaacaaaaagttccttgaaggtgctggactgctggaagtttttcgaatgctaggaaaatgaaagata |
42950332 |
T |
|
| Q |
120 |
acagtgttcgaatgctaggaaaagggaagataacggtgttatgtttcacatgcc-actaccttcatcttcttcaacagtatcaaacaaaatatcctttg |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42950331 |
acagtgttcgaatgctaggaaaatggaagataacggtgttatgtttcacatgccttataccttcatcttcttcaacagtatcaaacaaaatatcctttg |
42950233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 160 - 210
Target Start/End: Complemental strand, 2852033 - 2851983
Alignment:
| Q |
160 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2852033 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2851983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 160 - 210
Target Start/End: Complemental strand, 2904065 - 2904015
Alignment:
| Q |
160 |
atgtttcacatgccactaccttcatcttcttcaacagtatcaaacaaaata |
210 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
2904065 |
atgtttcacatgccactaccttcatcttcgtcaacaatatcaaacaaaata |
2904015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University