View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1135_low_14 (Length: 333)
Name: NF1135_low_14
Description: NF1135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1135_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 104 - 333
Target Start/End: Original strand, 15414717 - 15414946
Alignment:
| Q |
104 |
atgttcatggagctaccaaccgggttgcactagatcaacattttctccttcattccatttaaattcaagacatccaactcttttaacccttaactctaac |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15414717 |
atgttcatggagctaccaaccgggttgcactagatcaacattttcttcttcattccatttaaattcaagacatccaactcttttaacccttaactataac |
15414816 |
T |
|
| Q |
204 |
cagttgattttaactaagttagttaattataaccaattttcttcatatcataactaacgtgtaattaccttaaacaatattcaacaaattgtaacatatg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15414817 |
cagttgattttaactaagttagttaattataaccaattttcttcgtatcataactaacgtgtaattaccttaaacaatattcaacaaattgtaacatatg |
15414916 |
T |
|
| Q |
304 |
atttggtttaggggattgaccatatctacc |
333 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
15414917 |
atttggtttatgggattgaccatatctacc |
15414946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University