View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1135_low_21 (Length: 274)
Name: NF1135_low_21
Description: NF1135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1135_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 29 - 226
Target Start/End: Complemental strand, 43802385 - 43802188
Alignment:
| Q |
29 |
aatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactctt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802385 |
aatatccaagtaacttaactttgacaaatcattttcttctactaatttgttcgccccaaccacgttatctagctcttgttggagatttttcatcactctt |
43802286 |
T |
|
| Q |
129 |
ggatgcctcatgagctctgataaagcccactccacaactgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43802285 |
ggatgcctcatgagctctgataaagcccactccacaaccgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
43802188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 29 - 226
Target Start/End: Complemental strand, 43812954 - 43812757
Alignment:
| Q |
29 |
aatatccaagtaacttaactttgacaaatcattttcttctactaatttcttcgccccaaccacgttatctagctcttgttggagatttttcatcactctt |
128 |
Q |
| |
|
|||||| |||||||||||||||| || |||||| || || |||||||| ||| |||||| || |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
43812954 |
aatatctaagtaacttaactttgccatatcattctcctccactaatttgttcatcccaactacactatccagctcttgttggagatttttcattactctt |
43812855 |
T |
|
| Q |
129 |
ggatgcctcatgagctctgataaagcccactccacaactgttgcggaagtttcaaatgccccggcaatcatgtctagggatatagcctttatgtttgt |
226 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||| ||||| ||||||||| |||| |||||||||| || |||||||||||||||||| |
|
|
| T |
43812854 |
ggatgcctcatgagctcggataaagcccactccacaatggttgcagaagtgtcaaatgccgcggcgatcatgtctaaggctatagcctttatgtttgt |
43812757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 160
Target Start/End: Complemental strand, 29944776 - 29944727
Alignment:
| Q |
111 |
agatttttcatcactcttggatgcctcatgagctctgataaagcccactc |
160 |
Q |
| |
|
|||||||||||||||||||||||||| | || || |||||||||||||| |
|
|
| T |
29944776 |
agatttttcatcactcttggatgccttaaaagttcggataaagcccactc |
29944727 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University