View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1135_low_22 (Length: 257)
Name: NF1135_low_22
Description: NF1135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1135_low_22 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 30 - 257
Target Start/End: Complemental strand, 44866395 - 44866168
Alignment:
| Q |
30 |
ctttttccttgatgcaatcgttagccctaattttttcaatttactggatatttgagctgaagatattttaccatctggatctagcacttcagcaatacgt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44866395 |
ctttttccttgatgcaatcgttagccctaattttttcaatttactggatatttgagctgtagatattttaccatctggatcaagcacttcagcaatacgt |
44866296 |
T |
|
| Q |
130 |
cgactgcaatttcggtcatctttgaatctgatatgttcaaggcatggaagaaccgattatcaaaatgaatttatcatttaataaacaagnnnnnnnnnnc |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
44866295 |
cgactgcaatttcggtcatctttgaatctgatatgttcaaggcatggaagaaccgattatcaaaatgaatttatcattttataaacaagaaaaaaaaaac |
44866196 |
T |
|
| Q |
230 |
tgacaagctattaatttatttattaggc |
257 |
Q |
| |
|
|||||||||||||||| |||||| |||| |
|
|
| T |
44866195 |
tgacaagctattaattaatttatcaggc |
44866168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University