View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1135_low_24 (Length: 251)
Name: NF1135_low_24
Description: NF1135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1135_low_24 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 21376964 - 21377207
Alignment:
| Q |
1 |
ggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctacctcatctttgctaaaccacatgaatatagcgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21376964 |
ggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctaccttatctttgctaaaccacatgaatatagcgcc |
21377063 |
T |
|
| Q |
101 |
ttctgctannnnnnnagaacgagaccttctcgttgcagtcttcagaatgagacctttcttcattgtgtttgagactgcaacttttcccttaggatatgac |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
21377064 |
ttctgctatttttttagaacgagaccttctcgttgcagtcttcagaatgagacctttcttcattgtgtttgagactgcaacttttcccttaggatatggc |
21377163 |
T |
|
| Q |
201 |
atcaatttggcttcactaattctgag-ttttctctccctatgat |
243 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
21377164 |
atcaatttggcttcactaattctgagtttttctctcccaatgat |
21377207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 127 - 242
Target Start/End: Complemental strand, 36186198 - 36186082
Alignment:
| Q |
127 |
ttctcgttgcagtcttcagaatgagacctttcttcattgtgtttgagactgcaacttttcccttaggatatgacatcaatttggcttcactaattctgag |
226 |
Q |
| |
|
|||||||||||||||||| || || | |||||||| ||| | ||||||||| ||||| |||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
36186198 |
ttctcgttgcagtcttcaaaacgaaatttttcttcactgtatccgagactgcagcttttgccttaggatatggcatcaattaggcttcactaattatgag |
36186099 |
T |
|
| Q |
227 |
tt-ttctctccctatga |
242 |
Q |
| |
|
|| ||||||||| |||| |
|
|
| T |
36186098 |
ttcttctctcccaatga |
36186082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University