View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1135_low_25 (Length: 250)
Name: NF1135_low_25
Description: NF1135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1135_low_25 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 101 - 250
Target Start/End: Complemental strand, 4712679 - 4712528
Alignment:
| Q |
101 |
ggcaaatagtccggtaactaaactcacacac--taaatgtgaagaacttgaacattgttgattagaatttgcgcttctacatatcaaatgtctcgcaact |
198 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4712679 |
ggcaaatagttcggtaactaaactcacacacactaaatgtgaagaacttgaacattgttgattagaatttgcgcttctacatatcaaatgtctcgcaact |
4712580 |
T |
|
| Q |
199 |
ttttatcatttgaactgcgcttactcaaattaattacaaaaacaaaaatgct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4712579 |
ttttatcatttgaactgcgcttactcaaattaattacaaaaacaaaaatgct |
4712528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University