View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11361_high_8 (Length: 256)
Name: NF11361_high_8
Description: NF11361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11361_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 19 - 187
Target Start/End: Original strand, 44086796 - 44086952
Alignment:
| Q |
19 |
taaattggcaatcttgtgttcagcttagtgagtttcttaccttgcccttctctttctcaaacacctttaagcattttcgatttcacctttaagcgacaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
44086796 |
taaattggcaatcttgtgttcagcttagtgagtttcttaccttgcccttctctttctcaaacacctttaagcattttctatttcagcttt---------- |
44086885 |
T |
 |
| Q |
119 |
gatggagggtgagataagaaatcccaggataactcgaattctagttgggttgtgaaaagcagaaaacat |
187 |
Q |
| |
|
| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086886 |
--tcaatggtgagataagaaatcccaggataactcgaattctagttgggttgtgaaaagcagaaaacat |
44086952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 204 - 246
Target Start/End: Original strand, 44086946 - 44086988
Alignment:
| Q |
204 |
aaaacattcagcatttactgtagtcttctattttcatctctct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44086946 |
aaaacattcagcatttactgtagtcttctattttcatctctct |
44086988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University