View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11361_low_11 (Length: 227)
Name: NF11361_low_11
Description: NF11361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11361_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 37323138 - 37322909
Alignment:
| Q |
1 |
atcttaaattaattaattttttggtattaattttattgggttcatgtcttcttctcgtcacaggtttgcacgcatcaacatgtgtttgaaaacaccaacg |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37323138 |
atcttaaattaattaattttttggaattaattttatttggtacatgtcttcttctcgtcacaggtttgcacgcatcaacatgtgtttgaaaacaccaacg |
37323039 |
T |
|
| Q |
101 |
tgtgagtcctcttgt--------gatttgcacatgcaaactcatttctacgccaattcttaatgaggtgagatcatgtcgttgatcccatgatggtcaac |
192 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37323038 |
tgtgagtcctcttgtcctcttgtgatttgcaaatgcaaactcatttctgcgccaattcttaatgaggtgagatcatgtcgttgatcccatgatggtcaac |
37322939 |
T |
|
| Q |
193 |
tgatcccatccctccattttggttgcctct |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37322938 |
tgatcccatccctccattttggttgcctct |
37322909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University