View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11361_low_6 (Length: 330)
Name: NF11361_low_6
Description: NF11361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11361_low_6 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 103 - 330
Target Start/End: Original strand, 19336273 - 19336498
Alignment:
| Q |
103 |
aataatgatacttgtacaaccagtttgtgatgatctactttttctttcttcttatggatataaaaaacaatagagataaaaatgaagagtcagaaagtaa |
202 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||||||||| || |||||||| | ||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
19336273 |
aataatgatacttgtactaccagtttgtgatgatctacattttctttcctcctatggata-ataaaacaatagagagaaaaatgaagagacagaaagtaa |
19336371 |
T |
|
| Q |
203 |
gaacgcaacgtgagtatgagagaaggttatttaaaatttgtcataaaatagttgtaccagaagaagaatacatctctcatttttgcaacactttttagta |
302 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19336372 |
gaacgcaacgtgagtatgagagaaagttatttaaa-tttgtcataaaatagttgtaccagaagaagaatacatctctcatttttgcaacactttttagta |
19336470 |
T |
|
| Q |
303 |
gcaaagataagaaaaataaaaatatcac |
330 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19336471 |
acaaagataagaaaaataaaaatatcac |
19336498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University