View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11361_low_8 (Length: 296)
Name: NF11361_low_8
Description: NF11361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11361_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 118 - 270
Target Start/End: Original strand, 17238351 - 17238503
Alignment:
| Q |
118 |
agaggttacactgcatcactttttcatcttcttctttttgagctaagattgcatcaatgatatctagtttgagcaatcttgctttccgttgtgagttccc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| ||||||| |||||| |
|
|
| T |
17238351 |
agaggttacactgcatcactttttcatcttcttctttttgagttaagattgcatcaatgatatctagtttgagcaatcttacttttcgttgtgtgttccc |
17238450 |
T |
|
| Q |
218 |
ctagttgtattcaactttttgatagttcagggccatggattctatgttcttca |
270 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17238451 |
ctagttgtattcaactttttgatggttcagggccatggattctatgttcttca |
17238503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University