View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11362_high_11 (Length: 284)
Name: NF11362_high_11
Description: NF11362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11362_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 279
Target Start/End: Original strand, 43860695 - 43860954
Alignment:
| Q |
20 |
gcataaatatgtatagactcgtctctagctagcttgataaattactaacagcatctctagtagccaatgtgagtatatcagcacatgaaacaattcctgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43860695 |
gcataaatatgtatagactcgtctctagctagcttgataaattactaacagcatctctagtagccaatgtgagtatatcagcacatgaaacaattcctgg |
43860794 |
T |
|
| Q |
120 |
acatttttcctccaaagcttcttttatgtcttctattacatcaaagcctgctaatgataaattaggaatggcatccttctccgccgtgttaccagcagtg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43860795 |
acatttttcctccaaagcttcttttatgtcttctattacatcaaagcctgctaatgataaattaggaatggcatccttctccgccgtgttaccagcagtg |
43860894 |
T |
|
| Q |
220 |
gactccaacaaaaccgatgcgtcacacccctgaaacgcaaccatagatattcatctcact |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
43860895 |
gactccaacaaaaccgatgcgtcacacccctgaaacgcaaccatagatatgcatgtcact |
43860954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University