View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11362_low_20 (Length: 239)
Name: NF11362_low_20
Description: NF11362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11362_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 15 - 224
Target Start/End: Complemental strand, 43762885 - 43762675
Alignment:
| Q |
15 |
gaaatgggatgcctatacaagcatggttcttcaaaaacgcctctcaaaattcttatgagttgctgttgccagatccacatattaatctttgaaagtccac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43762885 |
gaaatgggatgcctatacaagcatggttcttcaaaaacgcctctcaaaattcttatgagttgctgttgccagatccacatattaatctttgaaagtccat |
43762786 |
T |
 |
| Q |
115 |
gataa-tgctaaacaagagtagctctgtaaagtttactgcaaattttcatgtcttacaaaaataactttcaatctctgaagttaggtggcaaagtttcac |
213 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43762785 |
gataaatgctaaacaagagtagctctgtaaagtttactgcaaattttcatgtcttacaaaaataactttcaatctctgaagttaggtggcaaagtttcac |
43762686 |
T |
 |
| Q |
214 |
ttgtaaaatat |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
43762685 |
ttgtaaaatat |
43762675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 165 - 224
Target Start/End: Complemental strand, 43757105 - 43757046
Alignment:
| Q |
165 |
tcttacaaaaataactttcaatctctgaagttaggtggcaaagtttcacttgtaaaatat |
224 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| ||||||||||| ||| |||||||||| |
|
|
| T |
43757105 |
tcttccaaaaataactttcaatctctgaagtttggtggcaaagtctcatctgtaaaatat |
43757046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University