View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11362_low_23 (Length: 223)
Name: NF11362_low_23
Description: NF11362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11362_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 73 - 209
Target Start/End: Original strand, 7166946 - 7167082
Alignment:
| Q |
73 |
ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166946 |
ggacctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaa |
7167045 |
T |
 |
| Q |
173 |
cagtttcggccatagaacccatattttattttctctg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7167046 |
cagtttcggccatagaacccatattttattttctctg |
7167082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 75 - 179
Target Start/End: Original strand, 7160310 - 7160414
Alignment:
| Q |
75 |
acctgggtcgcggactgttgctcgaaccatgtaaccgcgctccataagtctcatgacaagccatgacccgataaaacctgaagcccctgtgacacaaaca |
174 |
Q |
| |
|
|||||||||||| || || |||||||| |||| |||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
7160310 |
acctgggtcgcgcacggtggctcgaactgtgtagccgcgctccataagtctcataacaagccacgacccgatgaaacctgaagcccctgtgacgcaaact |
7160409 |
T |
 |
| Q |
175 |
gtttc |
179 |
Q |
| |
|
||||| |
|
|
| T |
7160410 |
gtttc |
7160414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 52
Target Start/End: Original strand, 7166887 - 7166922
Alignment:
| Q |
17 |
attgatttatacatgatatgaaaaatgttgcaacat |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7166887 |
attgatttatacatgatatgaaaaatgttgcaacat |
7166922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University