View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11362_low_9 (Length: 293)
Name: NF11362_low_9
Description: NF11362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11362_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 167 - 283
Target Start/End: Original strand, 965872 - 965988
Alignment:
| Q |
167 |
attgagtatggtggacaaatcttttccatcttgcattaaatgataagcatgttttgttcgagcttaacaaagtctttaaataaatgagttaattttgtta |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
965872 |
attgagtatggtggacaaatcttttccatcttgcattaaatgataagcatgttttgttcgagcttaacaaagtctttaaataaatgagttaattttgtta |
965971 |
T |
 |
| Q |
267 |
atggctttcatctctct |
283 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
965972 |
atggctttcatatctct |
965988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 80 - 168
Target Start/End: Original strand, 965743 - 965831
Alignment:
| Q |
80 |
cattaactcaatcattatttttcacagatcgctttgaatctctcatcaaaactatttcaattacgttttaaatggacacatccaacaat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
965743 |
cattaactcaatcattatttttcacagatcactttgaatctctcatcaaaactatttcaattaccttttaaatggacacatccaacaat |
965831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University