View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11363_high_6 (Length: 352)
Name: NF11363_high_6
Description: NF11363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11363_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 21 - 296
Target Start/End: Original strand, 48208398 - 48208673
Alignment:
| Q |
21 |
gatccatggttaagatgcaaaagatcccttgcaagtaagatatccacaaactcgtatgactcgtgcatataaacttttttaagtttttaaaattctaaaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48208398 |
gatccatggttaagatgcaaaagatcccttgcaagtaagatatccacacactcatatgactcgtgcatataaacttttttaattttttaaaattctaaaa |
48208497 |
T |
|
| Q |
121 |
ttgtgccaattactataaattttcatgtaatccatcaaaatcaacttaaaaaagaaaaccgattccataaagctctttccctcaatccacacaagacccc |
220 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48208498 |
ttgtgccaattaccataaattttcatgtaatccatcaaaatcaacttaaaaaagaaaaccgattccataaagctctttccctcaatccacacaagacccc |
48208597 |
T |
|
| Q |
221 |
cattcagactcgatctttcaattaattgaaatccaaattccatagcaagaaaagagaatctcatacatggttgtga |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48208598 |
cattcagactcgatctttcaattaattgaaatccaaattccatagcaagaaaagagaatctcatacatggttgtga |
48208673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University