View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11364_high_10 (Length: 253)
Name: NF11364_high_10
Description: NF11364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11364_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 28 - 235
Target Start/End: Complemental strand, 43664251 - 43664045
Alignment:
| Q |
28 |
ttcaaacacatcttaccacaatgcatctacaacaaacnnnnnnnnctaaataatttgacggcaattcctttcttggaatcaaggtcatacatgaccacaa |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43664251 |
ttcaaacacatcttaccacaatgcatctacaacaaacaaaaaaa-ctaaataatttgacggcaattcctttcttggaatcaaggtcatacatgaccacaa |
43664153 |
T |
|
| Q |
128 |
ataatcaaatattgttgtgggataaatatcacaaattttaatgccatgcaactcaaacattataaaatagcacaacaaatatatgattggtggtattgca |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43664152 |
ataatcaaatattgttgtgggataaatatcacaaattttaatgccatgcaactcaaacattataaaatagcacaagaaatatatgattggtggtattgca |
43664053 |
T |
|
| Q |
228 |
gctctagt |
235 |
Q |
| |
|
|||||||| |
|
|
| T |
43664052 |
gctctagt |
43664045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 43664307 - 43664276
Alignment:
| Q |
1 |
atttttatttaaccagtaatccactgattcaa |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43664307 |
atttttatttaaccagtaatccactgattcaa |
43664276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University