View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11364_low_11 (Length: 253)

Name: NF11364_low_11
Description: NF11364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11364_low_11
NF11364_low_11
[»] chr3 (2 HSPs)
chr3 (28-235)||(43664045-43664251)
chr3 (1-32)||(43664276-43664307)


Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 28 - 235
Target Start/End: Complemental strand, 43664251 - 43664045
Alignment:
28 ttcaaacacatcttaccacaatgcatctacaacaaacnnnnnnnnctaaataatttgacggcaattcctttcttggaatcaaggtcatacatgaccacaa 127  Q
    |||||||||||||||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43664251 ttcaaacacatcttaccacaatgcatctacaacaaacaaaaaaa-ctaaataatttgacggcaattcctttcttggaatcaaggtcatacatgaccacaa 43664153  T
128 ataatcaaatattgttgtgggataaatatcacaaattttaatgccatgcaactcaaacattataaaatagcacaacaaatatatgattggtggtattgca 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
43664152 ataatcaaatattgttgtgggataaatatcacaaattttaatgccatgcaactcaaacattataaaatagcacaagaaatatatgattggtggtattgca 43664053  T
228 gctctagt 235  Q
    ||||||||    
43664052 gctctagt 43664045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 43664307 - 43664276
Alignment:
1 atttttatttaaccagtaatccactgattcaa 32  Q
    ||||||||||||||||||||||||||||||||    
43664307 atttttatttaaccagtaatccactgattcaa 43664276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University