View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11364_low_13 (Length: 220)
Name: NF11364_low_13
Description: NF11364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11364_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 15 - 182
Target Start/End: Original strand, 16969530 - 16969698
Alignment:
| Q |
15 |
aagaacaacaacaaaaagtgtttgaagggatgaaaaggttaactttaagaatgtgatgtcatgagatgagatgctacaaaa-gattttaacactgacaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
16969530 |
aagaacaacaacaaaaagtgtttgaagggatgaaaaggttaactttaagaatgtgatgtcatgaaatgagatgctacaaaaagattttaacactgacaga |
16969629 |
T |
 |
| Q |
114 |
gtaaagagagaaacgtgtaaatggcgccaaactagaagaagaattgatttgatatcaaactaaacaaaa |
182 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16969630 |
gtagagagagaaacgtgtaaatggcgccaaactagaagaagaattgatttgatatcaaattaaacaaaa |
16969698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University