View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11365_high_6 (Length: 311)

Name: NF11365_high_6
Description: NF11365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11365_high_6
NF11365_high_6
[»] chr6 (1 HSPs)
chr6 (1-199)||(33756985-33757183)


Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 33757183 - 33756985
Alignment:
1 aaaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33757183 aaaagtggttcgaattggtgtattggaaataacattgagaatttgaagagcttgattttctgccatcgttgcgaggagtcgtatcgttgaaggatcgagt 33757084  T
101 ggtggctgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataactaactttcac 199  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
33757083 ggtggttgtgattgtttcacgcatatttggtttattagattttctacggatgccggaagtgtcaccggtggttgctccgtcgccataacaaactttcac 33756985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University