View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11367_high_12 (Length: 284)
Name: NF11367_high_12
Description: NF11367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11367_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 78
Target Start/End: Complemental strand, 32154035 - 32153972
Alignment:
| Q |
15 |
aacatggagcacgggttaaatgctcaattatcaagtctattgagttttcattgattcaattaac |
78 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32154035 |
aacatggagcacaagtaaaatgctcaattatcaagtctattgagttttcattgattcaactaac |
32153972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 213 - 269
Target Start/End: Complemental strand, 17877771 - 17877715
Alignment:
| Q |
213 |
tagtatggagccatttttacggaaaacaacgattgaattagatgtgcatttgttatt |
269 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||||||||| | |||||| |||||||||| |
|
|
| T |
17877771 |
tagtacggagccattttcacgaaaaacaacgattgaacttgatgtgtatttgttatt |
17877715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 219 - 269
Target Start/End: Complemental strand, 10417745 - 10417695
Alignment:
| Q |
219 |
ggagccatttttacggaaaacaacgattgaattagatgtgcatttgttatt |
269 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| | |||||| |||||||||| |
|
|
| T |
10417745 |
ggagccattttcacgaaaaacaacgattgaacttgatgtgtatttgttatt |
10417695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University