View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11367_high_20 (Length: 238)
Name: NF11367_high_20
Description: NF11367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11367_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2190620 - 2190399
Alignment:
| Q |
1 |
taatgaaagagaagcaacatgtgtcagtaattggtggaaatgatttgaatgctgttggtgagggtagaggaaatgttttgtcattgaaattggataggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2190620 |
taatgaaagagaagcaacatgtgtcagtaattggtggaaatgatttgaatgctgttggtgagggtagaggaaatgttttgtcattgaaattggataggtt |
2190521 |
T |
|
| Q |
101 |
atcggattcggtttcggggatgactaatgttgatccaaaggggtatcttagtgttctttgtaacaatgttattgctagtgatgctgaggtttcagatttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2190520 |
atcggattcggtttcggggatgactaatgttgatccaaaggggtatcttagtgttctttgtaacaatgttattgctagtgatactgaggtttcagatttt |
2190421 |
T |
|
| Q |
201 |
aataaggcgatgttgttgttaa |
222 |
Q |
| |
|
|||||||||| ||||||||||| |
|
|
| T |
2190420 |
aataaggcgaggttgttgttaa |
2190399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 41 - 155
Target Start/End: Complemental strand, 25166241 - 25166127
Alignment:
| Q |
41 |
tgatttgaatgctgttggtgagggtagaggaaatgttttgtcattgaaattggataggttatcggattcggtttcggggatgactaatgttgatccaaag |
140 |
Q |
| |
|
|||||||| ||||||||||||||| ||||| | ||||||||| ||||||||||||||||| || ||||| ||||| |||||||||||||||||||| ||| |
|
|
| T |
25166241 |
tgatttgactgctgttggtgaggggagagggactgttttgtcgttgaaattggataggttgtccgattcagtttctgggatgactaatgttgatccgaag |
25166142 |
T |
|
| Q |
141 |
gggtatcttagtgtt |
155 |
Q |
| |
|
|||||||||| |||| |
|
|
| T |
25166141 |
gggtatcttactgtt |
25166127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University