View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11367_low_17 (Length: 247)
Name: NF11367_low_17
Description: NF11367
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11367_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 47285943 - 47286179
Alignment:
| Q |
1 |
ctgatttggtttctgatgaactgaaaattaccggtgttaaaacaggttgacatccgttttcccatccagctgtacctgatccagcgccgttaattataat |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47285943 |
ctgatttggtttctgatgaacggaaaattaccggtgttaaaacaggttgacgtccgttttcccatccagctgtacctgatccagcgccgttaattataat |
47286042 |
T |
 |
| Q |
101 |
aacatcgccgttaggtagaattaacatgtctcccattactcttgccattggcatattctcaataatccaactaggattcgaatccgttactttgagaaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286043 |
aacatcgccgttaggtagaattaacatgtctcccattactcttgccattggcatattctcaataatccaactaggattcgaatccgttactttgagaaat |
47286142 |
T |
 |
| Q |
201 |
ccacatgttttaagtgctggcatgaagttctttccct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47286143 |
ccacatgttttaagtgctggcatgaagttctttccct |
47286179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University