View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11369_high_10 (Length: 385)
Name: NF11369_high_10
Description: NF11369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11369_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 334; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 18 - 367
Target Start/End: Complemental strand, 40902899 - 40902550
Alignment:
| Q |
18 |
agagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaaccgagaagccaatgtaatcttccgtatttaaacgtatg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40902899 |
agagcagaatataaacggtatttaactgagaaaccgatgtaatcttccgtacttaaacgtaactgagaaaccaatgtaatcttccgtatttaaacgtatg |
40902800 |
T |
|
| Q |
118 |
tgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttggactccaactccatttc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40902799 |
tgtcacgccttcctgcagctgcactgtaggcagggcaatgaccagttcaacagcaggctgattttcttcatggttcagatttcgactccaactccatttc |
40902700 |
T |
|
| Q |
218 |
cagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgcttgtcagaagctaaactgaacgggtatggaaattgatgacagattggct |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40902699 |
cagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgcttgtcagaagctaaactgaacgggtatggaaattgatgacagattggct |
40902600 |
T |
|
| Q |
318 |
gatccacttgccataactccttctagaataacgtgttttcaccgtttccg |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40902599 |
gatccacttgccataactccttctagaataacgcgttttcaccgtttccg |
40902550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 170 - 357
Target Start/End: Complemental strand, 30149676 - 30149497
Alignment:
| Q |
170 |
gcaggctgattttcttcatggttcagatttggactccaactccatttccagttctgcacaccatcggatgcagacagtttctgtgctactatgaattgct |
269 |
Q |
| |
|
|||||| |||||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||| || ||||||||||||||||| |||||| || |
|
|
| T |
30149676 |
gcaggcagattttgttcatggttcagatttcgactccaacttcatttccagttctgcacaccatcggtctcatacagtttctgtgctactgtgaattcct |
30149577 |
T |
|
| Q |
270 |
tgtcagaagctaaactgaacgggtatggaaattgatgacagattggctgatccacttgccataactccttctagaataacgtgttttc |
357 |
Q |
| |
|
||||||||||||||| |||| ||| ||||||||| ||||||||| | ||||||||||||||||| ||||||| |||||||| |
|
|
| T |
30149576 |
tgtcagaagctaaacagaacaggtttggaaattg--------ttggctgattcccttgccataactccttccagaataatgtgttttc |
30149497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University