View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11369_high_19 (Length: 246)
Name: NF11369_high_19
Description: NF11369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11369_high_19 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 148 - 246
Target Start/End: Complemental strand, 25912523 - 25912425
Alignment:
| Q |
148 |
ggaaaatgattctctgctgtcaaatagtgaccgtagaatgatatcaaccatctgatctgttagaatagtttttatttcatttttgatctttaaatattc |
246 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||| ||| || |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25912523 |
ggaaaatgattctcaatagtcaaatagtgactgtagaatgatatcaaccgtctaatttgttagaatagtttttatttcacttttgatctttaaatattc |
25912425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 149 - 246
Target Start/End: Original strand, 16495238 - 16495335
Alignment:
| Q |
149 |
gaaaatgattctctgctgtcaaatagtgaccgtagaatgatatcaaccatctgatctgttagaatagtttttatttcatttttgatctttaaatattc |
246 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||| || |||||||| |||||| ||||||||||||| || ||||||||||| |||| |
|
|
| T |
16495238 |
gaaaatgattctctgcagtcaaatagtgactctagaatgatatcagccgtctgatctattagaacagtttttatttcacttctgatctttaaacattc |
16495335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 62; Significance: 7e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 12 - 81
Target Start/End: Original strand, 12322755 - 12322823
Alignment:
| Q |
12 |
agagacacgtgttgatgagaatatttcacgggatgggtgtttttattttgtgtgtgtcacggacgaatgg |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12322755 |
agagacacgtgttgatgagaatatttcacgggat-ggtgtttttattttgtgtgtgtcacggacgaatgg |
12322823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 166 - 245
Target Start/End: Original strand, 12322908 - 12322987
Alignment:
| Q |
166 |
gtcaaatagtgaccgtagaatgatatcaaccatctgatctgttagaatagtttttatttcatttttgatctttaaatatt |
245 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||| |||| |||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
12322908 |
gtcaagtagtgacggtagaatgatatcaaccatatgatatgttagaatagtttttatttcacttctgatctttaaatatt |
12322987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 188 - 246
Target Start/End: Original strand, 5434921 - 5434979
Alignment:
| Q |
188 |
atatcaaccatctgatctgttagaatagtttttatttcatttttgatctttaaatattc |
246 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
5434921 |
atatcaaccgtctgatctattagaatagtttttatttcacttcctatctttaaatattc |
5434979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University