View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11369_high_22 (Length: 241)
Name: NF11369_high_22
Description: NF11369
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11369_high_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 33327502 - 33327377
Alignment:
| Q |
1 |
tatgttgctgagttgactagtgaagtgaggagtgaatttaggtttgactcgtaaggtgagtttggtgtgtacatttgttgtgtgcaaccaccgtataggt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327502 |
tatgttgctgaattgactagtgaagtgaggagtgaatttaggtttgactcgtagggtgagtttggtgtgtacatttgttgtgtgcaaccaccgtataggt |
33327403 |
T |
|
| Q |
101 |
agaggtttgtggttgatgattctgat |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
33327402 |
agaggtttgtggttgatgattctgat |
33327377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 161 - 210
Target Start/End: Complemental strand, 33327342 - 33327293
Alignment:
| Q |
161 |
tgattttgaagaatctcaccattttttgttgttgttattggttgagagta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33327342 |
tgattttgaagaatctcaccattttttgttgttgttattggttgagagta |
33327293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University