View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1136_high_4 (Length: 297)
Name: NF1136_high_4
Description: NF1136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1136_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 72 - 294
Target Start/End: Original strand, 38581430 - 38581670
Alignment:
| Q |
72 |
atcacatatcacccttacaggtctcctgtatgcaaggaatggagnnnnnnntcctcaaaacgtgcttatttgttttctcttgctcttttattttaataac |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581430 |
atcacatatcacccttacaggtctcctgtatgcaaggaatggagccccccctcctcaaaacgtgcttatttgttttctcttgctcttttattttaataac |
38581529 |
T |
 |
| Q |
172 |
ctttcaattttggagggggtgtattttattaatg-----------------cacgcacggtgccaaaaaattatagggacacaaaaagccaacaa-gtaa |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38581530 |
ctttcaattttggagggggtgtattttattaatgcagatatttggttaatacacgcacagtgccaaaaaattatagggacacaaaaagccaacaacgtaa |
38581629 |
T |
 |
| Q |
254 |
cattgagggaatggaaccctttgtgttctaatttaacttgg |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38581630 |
cattgagggaatggaaccctttgtgttctaatttaacttgg |
38581670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University