View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1136_high_5 (Length: 273)
Name: NF1136_high_5
Description: NF1136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1136_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 52 - 224
Target Start/End: Complemental strand, 18325666 - 18325494
Alignment:
| Q |
52 |
atacttcccgatacacgcgagaggatgctggcaacagaagtaactgcactatggaggtaatttcttttttctgtactgagtcttagcctatacttggttc |
151 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
18325666 |
atacttcctgatacacgcgagaggatgctggcaacagaagtaactgcgctatggaggtaatttcttttttctgtactgagtgttggcctatatttggttc |
18325567 |
T |
 |
| Q |
152 |
aatgtttgtagcagccggaatcaattctaaaggtgtaaaattttgccatgtttggttgctctctcgagtagaa |
224 |
Q |
| |
|
||| |||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18325566 |
aatatttgtagctgctggaattgattctaaaggtgtaaaattttgccatgtttggttgctctctcgagtagaa |
18325494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University