View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1136_low_16 (Length: 254)
Name: NF1136_low_16
Description: NF1136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1136_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 30 - 245
Target Start/End: Original strand, 43894311 - 43894526
Alignment:
| Q |
30 |
tgttcgacactattctaatttggggttgctcttcattggtatctttaatttgttggtttgtaacagtgaattcgaccttagttgttgttgcttctgtgtc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43894311 |
tgttcgacactattctaatttggggttgctcttcattggaatctttaatttgttggtttgtaacagtgaattcgatcttagttgttgttgcttctgtgtc |
43894410 |
T |
|
| Q |
130 |
attatggtttggtttgttgtaactaattcgagccccaactcgttccagtctctaacttgatttgggaatacgagttaacatgccaccatttttccttgtc |
229 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43894411 |
attatggtttggtttgttgaaactagttcgagccctaactcgtaacagtctctaacttgatttgggaatacgagttaacatgccaccatttttccttgtc |
43894510 |
T |
|
| Q |
230 |
tgatatttggtctgtg |
245 |
Q |
| |
|
|||| |||||| |||| |
|
|
| T |
43894511 |
tgatttttggtttgtg |
43894526 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 43893516 - 43893545
Alignment:
| Q |
1 |
agaattaaaaagttataactaaagagtttt |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43893516 |
agaattaaaaagttataactaaagagtttt |
43893545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University