View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1136_low_4 (Length: 355)
Name: NF1136_low_4
Description: NF1136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1136_low_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 61 - 347
Target Start/End: Complemental strand, 31650923 - 31650638
Alignment:
| Q |
61 |
cgagtcagtgtctggtgtctgtattcataagttaattcatgacgtgctgcatcatatgaatgcgatagtcttttttg-gcttaattacacttttggtctc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
31650923 |
cgagtcagtgtctggtgtctgtattcataagttaattcatgacgtgctgcatcatatgaatgcgatagtcttttttttgcttaattacacttttagtctc |
31650824 |
T |
|
| Q |
160 |
tatagttaagagtttttctattttgtcccctctagattttccgaccgattttagtacctccatccaattatatttcacatagatcctttaatgtattgaa |
259 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||||||| | |||||||||||||| |||||||||||||||||| |
|
|
| T |
31650823 |
tatagtta-gagttttgctattttgtcccctctagattttctgaccgattttagtacctccatcga-ttatatttcacataaatcctttaatgtattgaa |
31650726 |
T |
|
| Q |
260 |
atatttatgtgtattgaatttgcagtcaaatacagccttgagtgtgcaacaagagaaaaggttaaagcaaatgggtgcaacagctagg |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31650725 |
atatttatgtgtattgaatttgcagtcaaatacagccttgagtgtgcaacaagagaaaaggttaaagcaaatgggtgcaacagttagg |
31650638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 29 - 72
Target Start/End: Complemental strand, 31650966 - 31650923
Alignment:
| Q |
29 |
agcaccgacagaatgcatgtctagtgtccgaacgagtcagtgtc |
72 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31650966 |
agcaccgacagaatatttgtctagtgtccgaacgagtcagtgtc |
31650923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University